This website uses cookies

We use cookies to enhance your experience and support COUNTER Metrics for transparent reporting of readership statistics. Cookie data is not sold to third parties or used for marketing purposes.

Skip to main content
null
Bulletin of the EAFP
  • Menu
  • Articles
    • Case study
    • Method
    • Note
    • Opinion
    • Research article
    • Review
    • Workshop Report
    • All
  • For Authors
  • Editorial Board
  • About
  • Issues
  • search
  • Facebook (opens in a new tab)
  • LinkedIn (opens in a new tab)
  • RSS feed (opens a modal with a link to feed)

RSS Feed

Enter the URL below into your favorite RSS reader.

http://localhost:20020/feed
P-ISSN 0108-0288
E-ISSN 3005-4648
Case study
Vol. 44, Issue 3, 2024September 27, 2024 CEST

Vibrio ponticus and Vibrio harveyi infection in snubnose pompano, Trachinotus blochii, from marine aquarium

Jiří Řehulka, Monika Havlíčková (Marejková), Petr Petráš, Soňa Peková,
Vibrio ponticusVibrio harveyisnubnose pompanomarine aquarium
Copyright Logoccby-4.0 • https://doi.org/10.48045/001c.124033
Photo by Yash Gupta on Unsplash
Bulletin of the EAFP
Řehulka, Jiří, Monika Havlíčková (Marejková), Petr Petráš, and Soňa Peková. 2024. “Vibrio Ponticus and Vibrio Harveyi Infection in Snubnose Pompano, Trachinotus Blochii, from Marine Aquarium.” Bulletin of the European Association of Fish Pathologists 44 (3). https://doi.org/10.48045/001c.124033.
Save article as...▾
Download all (2)
  • Figure 1. Clinical and histopathological changes in snubnose pompano with a mixed infection of Vibrio harveyi and Vibrio ponticus and a Cryptocaryon irritans ciliate infection.
    Download
  • Figure 2. Clinical and histopathological changes in internal organs in snubnose pompano with a mixed infection of Vibrio harveyi and Vibrio ponticus.
    Download

Error

Sorry, something went wrong. Please try again.

If this problem reoccurs, please contact Scholastica Support

Error message:

undefined

View more stats

Abstract

Vibriosis in a mixed community with Vibrio harveyi and Vibrio ponticus in adult snubnose pompano, Trachinotus blochii, is documented from a marine aquarium. The disease was clinically manifested by reduced feeding activity, lethargy, abnormal swimming behaviour, extensive and focal superficial ulceration in dorsal region, and mild opaque eye with haemorrhage. Histopathological examinations revealed moderate to severe epidermal necrosis and ulceration with scale pocket and dermal oedema. Scales were often displaced, distored or absent in skin sections. Cutaneous lesions were associated with a lymphocytic inflammatory infiltrate noted multifocally throughout the dermal layers. Grossly, the hepatopancreas had an area of pallor; on histological examination, the hepatopancreas displayed hepatocyte vacuolation and congestion.

Introduction

Identification of the causal agents of bacterial diseases in aquarium culture is an important part of the health care of ornamental fish, aimed at reducing infections. This applies to aquarium fish breeders as well as to public aquariums that enhance the attractiveness of zoos. The much-feared causative agents of acute bacterial diseases include the species of the genus Vibrio. According to Austin and Austin (2016), sixteen of 43 isolated species were classified as bacterial pathogens of freshwater and marine fish. Their pathogenicity was characterised as septicaemic lesions in acute cases. In sub-acute or chronic cases, ulcers may also be found.

Snubnose pompano is distributed throughout the Indian Ocean, and elsewhere in the Indo-West Pacific, from southern Japan to northern Australia and Lord Howe island, and eastwards to Samoa, Tonga, Marina and Marshall Islands (Smith-Vaniz, Collette, and Luckhurst 1999). According to Gopakumar (2011), this species has a high potential for aquaculture in India and is harvested from aquaculture in the Philippines and Malaysia (Ransangan, Lai, and Al-Harbi 2012; Amal et al. 2012).

An outbreak of vibriosis in a mixed community with Vibrio harveyi and Vibrio ponticus occurred in snubnose pompano in a marine aquarium of the zoo in the Czech Republic.

The present study is a first report describing co-infections by Vibrio ponticus and Vibrio harveyi in adult snubnose pompano, Trachinotus blochii. We recorded the gross signs of infection and observed the histological damage.

Material and methods

Fish collection

The fish came from a quarantine tank 2800 litres in size, where they were kept while the display tank was being refurbished. Water had the following physicochemical characteristics: temperature 25–26○C, pH 7.8–8.1, carbonate hardness 6.4 – 9.2 ° dKH, alkalinity 2.28 -3.3 mEq/L, orthophosphates (PO4 3- ) 1 – 2 mg/L, nitrates (NO3-) 50–100 mg/L, density of water 1.025 g/cm3.

Bacteriology

During the bacteriological examination, the methods Austin and Austin (2016) and Austin (2019) were respected. A total of six fish with clinical signs were sampled. Samples were taken from skin, eyes, kidney, liver and heart, and were streaked on blood agar (MKM 01011 Columbia agar; Trios) and tryptic soy agar (MKM 10061; Trios). Plates were then incubated at 24○C. Wet mounts of infected tissue from external lesions were checked under the microscope (×100 magnification).

Culture and phenotypic identification of the bacterial strains

Strains were inoculated on TCBS-selective medium for vibrios (thiosulphate-citrate-bile-sucrose agar) and Columbia blood agar (Oxoid). The commercial API 20 E kit and the apiweb software (BioMerieux, Marcy-l’Etoile, France), employed according to the manufacturer’s instructions, were used for identification of the strains of the Gram-negative oxidase-positive rods. Complementary conventional tests described previously by Farmer, Janda, Birkhead, et al. (2003) were also used.

MALDI-TOF mass spectrometry identification

For the analysis, cultures were grown on Columbia blood agar and transferred with a bamboo toothpick onto an MSP 96 polished steel target (Bruker Daltonics). The samples were covered with 1.0 μl matrix solution: a saturated solution of α-cyano-4-hydroxy-cinnamic acid (Sigma) in 50% acetonitrile and 2.5% trifluoroacetic acid. The samples were analysed using a MALDI-TOF mass spectrometer (Microflex LT, Bruker Daltonics, Germany). The recorded spectra were processed using the Flex Analysis (version 3.3) and BioTyper (version 3.0) software with the version 3.2.1.0 database and Security Relevant Library.

The Vibrio strains were deposited in the collection of cultures of the NRL for E. coli and Shigella (NRL/ECS), NIPH, Prague. Vibrio harveyi was deposited under number NRL/ECS 16/156, and Vibrio ponticus under number NRL/ECS 16/157. MALDI-TOF identification results of strains No. NRL/ECS 16/156 (E16-156) and NRL/ECS 16/157 (E16-157) (Flex Analysis Output Form and BioTyper software) are shown in Table 1.

Molecular identification

The results of phenotypic identification and MALDI-TOF mass spectrometry identification were verified by Sanger sequencing. Total DNA was isolated using QIAamp DNA Mini Kit (Qiagen, DE) according to the instructions of the manufacturer. 16S rDNA fragment was PCR-amplified using primers PSL for: AGGATTAGATACCCTGGTAGTCCA and P13P rev: AGGCCCGGGAACGTATTCAC. The obtained PCR products were directly sequenced on the ABI3500 genetic analyser (ThermoFisher Scientific, USA), using the BigDye Terminator v3.1 Cycle Sequencing Kit (ThermoFisher Scientific, USA), according to the recommendations of the manufacturer. Sequences of both Vibrio ponticus and Vibrio harveyi 16S rDNA diagnostic fragments have been deposited in NCBI gene bank under the accession numbers OQ451892 and OQ451893. The hybridization positions of both PSL and P13 primers as per their respective reference sequences were 826 bp - 1470 bp (producing a 643 bp fragment) for Vibrio ponticus (RefSeq NR_029032.1), and 785 bp – 1436 bp (producing a 652 bp fragment) for Vibrio harveyi (RefSeq NR_043165.1).

Parasitology

Parasitological examination was carried out according to Ergens and Lom (1970), Lom and Dyková (1992) and Moravec (2023). In the taxonomic placement of the isolated ciliate protozoan, we took into consideration that all Cryptocaryon isolates currently are considered members of one species (Colorni and Burgess 1997; Yambot, Song, and Sung 2003). The specimen was carefully examined for morphological characters following the previous descriptions of Wright and Colorni (2002) and Dyková and Lom (2007).

Sampling procedure for histopathology

Necropsy procedures were carried out according to Roberts (2012) and Noga (2010). After anaesthesia with Menocain (3-aminobenzoic acid ethyl ester sodium hydrogen sulphate at a concentration of 0.06g/L (Král 1988) and subsequent killing of the moribund fish using the cranial concussion, tissue samples of skin, gill, hepatopancreas, kidney and spleen were fixed in modified Davidson’s fixative, embedded in paraffin and sectioned at 5–7 µm. Histological sections were stained with haematoxylin-eosin, Sudan black B, PAS method (periodic acid-Shiff’s reagent), Gram method, Van Gieson stains, Masson’s trichrome staining, melan-A (MART-1) and Ki-67 (MKI67). The BX53 microscope (Olympus) with the digital camera DP73 (Olympus) was used for microscopic examination and photo documentation.

Results

Clinical and histopathological findings

Six of the fifteen affected fish with body weights ranging from 1.4 to 2.1 kg were examined and a complete necropsy was performed. Disease signs included reduced feeding activity, lethargy, abnormal swimming behaviour. Clinical signs included extensive and focal superficial skin lesions on dorsal region (Figure 1a) and unilateral or bilateral mild opaque eye coverings/eyeballs with haemorrhage into the anterior chamber (Figure 1b). External haemorrhages and petechia on the skin were not evident. Necropsy in moribund fish revealed a poorly defined area of pallor on the caudal aspect of the hepatopancreas (Figure 2a).

A collage of images of fish and a fish Description automatically generated
Figure 1.Clinical and histopathological changes in snubnose pompano with a mixed infection of Vibrio harveyi and Vibrio ponticus and a Cryptocaryon irritans ciliate infection.

(a) Extensive and focal superficial ulceration on dorsal region. (b) Opaque eye covering/eyballs with periocular haemorrhaging. (c) Mild spongiosis in epidermis, accumulation of erythrocytes (haemorrhage) and mild mixed inflammatory infiltration of lymphocytes and neutrophils within the oedematous stratum spongiosum. H-E.Scale bar = 60 µm. (d) Loss of epidermis was distributed over the affected area. H-E.Scale bar = 60 µm. (e) Scale pockets are enlarged, and there is multifocal inflammatory infiltration with oedema of all dermal layers. H-E. Scale bar = 150 µm. (f) Normal gill and early trofont of Cryptocaryon irritans growing in epithelium of gill filament. H-E. Scale bar = 150 µm, scale bar of insert = 60 µm.

Histopathological examinations revealed moderate to severe epidermal necrosis; enlarged scale pockets were mild, and there were marked scale pocked oedema, disarrangement and irregularity of the stratum compactum and lifting of its superficial layers into the oedematous stratum spongiosum. Scales were often displaced, distorted or absent in skin sections. Lesions were associated with inflammatory responses and included mixed lymphocytic cellular aggregates distributed, for the most part, focally throughout the dermal layers (Figure 1c-1e). Hypodermis and subcuticular muscle were not affected. The hepatopancreas displayed vacuolation of hepatocytes and hepatic vein and artery congestion (Figures 2a, 2b). In some sections of the primary lamellae, the loss of the secondary lamellae and the presence of early of trophonts of Cryptocoryon irritans in the epithelium were seen (Figure 1f ).

A close-up of a microscope Description automatically generated
Figure 2.Clinical and histopathological changes in internal organs in snubnose pompano with a mixed infection of Vibrio harveyi and Vibrio ponticus.

(a) Pale area on hepatopancreas (arrows). Insert: Detail of vacuolation of hepatocytes. H-E. Scale bar = 30 µm. (b) Hepatic vein congestion. H-E. Scale bar = 60 µm.

Bacteriology

On the primary plates, both Vibrio species isolated in mixed culture from all the fish were recovered from the edges of skin lesions as sparse to rich cultures. V. harveyi recovered from the ocular lesions was present as sparse culture in two fish and as rich culture in four fish. V. ponticus obtained from liver was isolated as sparse culture in four fish and as rich culture in two fish. In a microscopic wet mount examination the detected gliding movement of these bacteria, which occasionally forms filaments, was not observed. The bacteria were also not found in imprint preparations and in histological sections as gram – rods..

Characteristics of the bacterial strains

Phenotypic biochemical characteristics

Both the strains, no. NRL/ECS 16/156 and no. NRL/ECS 16/157, were oxidase-positive, well grown on TCBS agar (and Columbia blood agar) after incubation at 25○C and with no growth observed in nutrient broth of 8% NaCl.

Strain no. NRL/ECS 16/156: acid was produced from sucrose, trehalose, salicin and glucose (without gas), but not from lactose, sorbitol, xylose and mucate. Lysine decarboxylase, ornithine decarboxylase and indol were produced, but not H2S, beta-galactosidase and arginine dihydrolase. Nitrates were reduced, Voges-Proskauer reaction and methyl red test were negative.

Strain no. NRL/ECS 16/157: Acid was produced from mannitol, sucrose, trehalose, xylose and glucose (without gas), but not from adonitol, arabinose, inositol, melibiose, rhamnose, lactose, sorbitol, salicin and mucate. Indol was produced, but not lysine decarboxylase, ornithine decarboxylase, arginine dihydrolase, H2S and beta-galactosidase. Nitrates were also reduced, Voges-Proskauer reaction and methyl red test were negative, and strain could not utilize citrate, gelatine and urea. V. ponticus was suspected as probable species.

MALDI-TOF mass spectrometry results

Strain no. NRL/ECS 16/156 was measured twice and identified as Vibrio harveyi with a best log score of 2.232. It was therefore identified at the genus level and probable species level (Table 1).

Table 1.Results of MALDI-TOF identification of strains no. NRL/ECS 16/156 (E16-156) and NRL/ECS 16/157 (E16-157) (Output form Flex Analysis and BioTyper software)
Analyte
Name
Analyte
ID
Organism
(best match)
Score
Value
Organism
(second best match)
Score
Value
H8
( ++ ) ( A )
E16-156 Vibrio harveyi 2.206 Vibrio mytili 1.877
H9
( ++ ) ( A )
E16-156 Vibrio harveyi 2.232 Vibrio parahaemolyticus 1.855
H10
( + ) ( B )
E16-157 Vibrio ponticus 1.926 identification not reliable 1.536
H11
( - ) ( C )
E16-157 identification not reliable 1.645 identification not reliable 1.453

Strain no. NRL/ECS 16/157 was measured twice and identified as Vibrio ponticus with a best log score of 1.926. It was therefore identified at probable genus level (Table 1).

Molecular characterization of the strains

Using the 16S rDNA sequencing it is only possible to precisely identify the type of bacteria (100% homology with the respective reference sequences). The exact identity of the bacterial strain / isolate involved should be identified using more detailed genetic mapping, not performed in this study.

Discussion

The first serious health problems observed in snubnose pompano were associated with the occurrence of nocardiosis, caused by Nocardia seriolae, in Malaysia and China (Labrie et al. 2008) and in Vietnam (Vu-Khac et al. 2016). Mass mortality of 58-day-old snubnose pompano fry exhibiting clinical signs typical of VNN (viral nervous necrosis) in a hatchery in the Philippines is described by Pakingking et al. (2011). An outbreak of Streptococcus agalactiae infection in cage-cultured golden pompano in Malaysia was reported by Amal et al. (2012), and outbreaks in skin flukes Neobenedenia girellae infection in snubnose pompano from a public aquarium in Korea are described by Nam et al. (2020).

Ocular lesions caused by V. harveyi in cage-cultured pompano broodstock are described by Pakingking et al. (2018). They noted that gross examinations of diseased fish samples were typified by obvious haemorrhagic lesions and mild to severe exophthalmia. Hispano, Nebra, and Blanch (1997) describe the isolation of V. harveyi associated with an ocular lesion in short sunfish (Mola mola) held in captivity in display tanks in Barcelona. Muroga et al. (1984) isolated Vibrio sp. from milkfish (Chanos chanos) juveniles with unilateral and bilateral opaque eye covering/eyeballs, exophthalmia and haemorrhagic eyes. Pakingking and Bautista (2018) attempted to elucidate the putative aetiology of the exophthalmia among net-cage-cultured pompano broodfish by examining the identity and pathogenicity of the bacterial strains isolated in pure culture from the exophthalmic eyes and brains of pompano broodfish infected with Lepeophtherius spinifer through biochemical characterisation and genetic analysis of the 16SrRNA sequence and infection challenges, respectively. Yu et al. (2018) describe skin and muscle ulceration, internal organs swelling and congestion in naturally diseased cultured golden pompano (Trachinotus ovatus).

Except of negative lysine decarboxylase and beta-galactosidase biochemical characteristics of the strain no. NRL/ECS 16/157 lead us to identication V. ponticus, as described in Gai et al. (2022). However further approaches as MALDI TOF and 16S rRNA were necessary to support and confirm species level identification.

As a new pathogenic agent, V. ponticus, which caused vibriosis in cultured Japanese sea bass (Lateolabrax japonicus) in China, is described by Xie et al. (2007). Moribund fish swam slowly on the surface of the water and had different degrees of ulcerations, ranging from a red blot to visible holes in some places on the fishes’ bodies (e.g., the cauda). Pathological signs in diseased golden pompano due to Vibrio ponticus are described by Liu et al. (2018). They state that the diseased fish had swollen and hyperaemic liver and spleen, yellowish effusion in the gut, and different degrees of ulcerations on the bases of the dorsal and pelvic fins. Some of the fish had hyperaemia of the eyes.

The condition described above is a case of co-infection with two dominant bacterial pathogens of marine fish (Austin and Austin 2016), which, combined with a parasitic infection, contributed to the severe course of the disease. Occurrence of mixed bacterial infections is not uncommon even in freshwater fish: for example, farmed rainbow trout were infected with Aeromonas hydrophila and Flavobacterium columnare (Řehulka and Mráz 1982) or with coagulase-negative staphylococci (CoNS), of which seven (S.capitis, S. cohnii subsp. urealyticus, S. haemolyticus, S. petrasii subsp.pragensis, S. saprophyticus, S. warneri, S. xylosus) were isolated from co-infections in fish with bacterial, viral or parasitic infections (Řehulka, Marejková, and Petráš 2020). A mixed infection with A. hydrophila isolated from fish with columnaris is also reported by Scott and Bollinger (2014). In addition, Pseudomonas anguilliseptica was found with Delftia acidovorans in European eel (Andree et al. 2013), and Moritella viscosa and Aliivibrio wodanis occurred in salmon with winter ulcer disease (Hjerde et al. 2015).

Our results provide an opportunity to assess coinfections with Cryptocaryon irritans. V. harveyi co-infection with C.irritans in orange-spotted grouper Epinephelus coioides is described by Lai et al. (2023). These authors established a C. irritans high-dose local-infected model, causing mortality of groupers, which had a low vitality; histopathological analysis demonstrated an inflammatory response and degeneration in infected skin, gill and liver. Based on the morbidity symptom occurring in non-infected organs, the authors hypothesized that the results of morbidity and mortality were due to secondary bacterial infection after parasitism by C. irritans. We found C.irritans trophonts only in the gills growing mainly in the epithelium at the top of the gill filaments.

In our study, we observed many of the signs described by the authors mentioned above, and our results confirm that the two vibrios are among the feared pathogens that cause the gross signs whose primary manifestations include ocular lesions or dermal ulceration. Our results also enhance the knowledge concerning mixed vibrio infections in snubnose pompano under stress conditions associated with mortalities. The involvement of V. ponticus in the development of pathological changes in these organs will have to be verified experimentally.

Submitted: December 02, 2022 CEST

Accepted: September 27, 2024 CEST

References

Amal, M. N. A., M. Zamri-Saad, A. R. Iftikhar, A. Siti-Zahrah, S. Aziel, and S. Fahmi. 2012. “An Outbreak of Streptococcus Agalactiae Infection in Cage-Cultured Golden Pompano, Trachinotus Blochii (Lacépède), in Malaysia.” Journal of Fish Diseases 35:849–52. https:/​/​doi.org/​10.1111/​j.1365-2761.2012.01443.x.
Google Scholar
Andree, K. R., C. J. Rodgers, D. Furones, and E. Gisbert. 2013. “Co-Infection with Pseudomonas Anguilliseptica and Delftia Acidovorans in the European Eel, Anguilla Aguilla (L.).” Journal of Fish Diseases 36:647–56. https:/​/​doi.org/​10.1111/​jfd.12066.
Google Scholar
Austin, B. 2019. “Methods for the Diagnosis of Bacterial Fish Diseases.” Marine Life Science & Technology 1:41–49. https:/​/​doi.org/​10.1007/​s42995-019-00002-5.
Google Scholar
Austin, B., and D. A. Austin. 2016. Bacterial Fish Pathogens. Diseases of Farmed and Wild Fish. 6th edition. Springer International Publishing. https:/​/​doi.org/​10.1007/​978-3-319-32674-0.
Google Scholar
Colorni, A., and P. Burgess. 1997. “Cryptocaryon Irritans Brown 1951, the Cause of ‘White Spot Disease in Marine Fish: An Update.’” Aquarium Sciences and Conservation 1:217–38. https:/​/​doi.org/​10.1023/​A:1018360323287.
Google Scholar
Dyková, I., and J. Lom. 2007. Histopathology of Protistan and Myxozoan Infections in Fishes: An Atlas. Praha.
Google Scholar
Ergens, R., and J. Lom. 1970. Causative Agents of Parasitic Diseases of Fish. Academia.
Google Scholar
Farmer, J. J., III, J. M. Janda, K. Birkhead, et al. 2003. “Vibrio.” In Manual of Clinical Microbiology, edited by E. J. Murray et al., 706–18. Washington, D.C.: ASM Press. https:/​/​doi.org/​10.1128/​JCM.41.12.5654-5659.2003.
Google Scholar
Gai, C., J. Liu, X. Zheng, L. Xu, and H. Ye. 2022. “Identification of Vibrio Ponticus as a Bacterial Pathogen of Coral Trout Plectropomus Leopardus.” Front. Cell. Infect. Microbiol. 12:1089247. https:/​/​doi.org/​10.3389/​fcimb.2022.1089247.
Google Scholar
Gopakumar, G. 2011. “Development of Cobia (Rachycentron Canadum) and Pompano (Trachinotus Blochii).” Aquaculture in India. Fishing Chimes 31:56. http:/​/​eprints.cmfri.org.in/​id/​eprint/​8814.
Google Scholar
Hispano, C., Y. Nebra, and A. R. Blanch. 1997. “Isolation of Vibrio Harveyi from an Ocular Lesion in the Short Sunfish (Mola Mola).” Bulletin of the European Association of Fish Pathologists 17:104–7.
Google Scholar
Hjerde, E., C. Karlsen, H. Sørum, J. Parkhill, N. P. Willassen, and N. R. Thomson. 2015. “Co-Cultivation and Transcriptome Sequencing of Two Coexisting Fish Pathogens Moritella Viscosa and Aliivibrio Wodanis.” BMC Genom 16:447. https:/​/​doi.org/​10.1186/​s12864-015-1669-z.
Google Scholar
Král, J. 1988. “Studying the Action of Menocain (Spofa) (3-Aminobenzoic Acid Ethylester Sodium Hydrogen Sulphate), a New Anaesthetic for Fish.” Biological and Chemical Factors in Animal Production Veterinaria 24:101–9.
Google Scholar
Labrie, L., J. Ng, Z. Tan, C. Komar, E. Ho, and L. Grisez. 2008. “Nocardial Infections in Fish, an Emerging Problem in Both Freshwater and Marine Aquaculture Systems in Asia.” In Diseases in Asian Aquaculture VI, edited by M. G. Bondad-Reantaso, C. V. Mohan, M. Crumlish, and R. P. Subasinghe, 297–312. Manila, Philippines: Fish Health Section, Asian Fisheries Society.
Google Scholar
Lai, X., H. Wu, W. Guo, X. Li, J. Wang, Y. Duan, P. Zhang, et al. 2023. “Document Details-Vibrio Harveyi Co-Infected with Cryptocaryon Irritans to Orange-Spotted Groupers Epinephelus.” Fish and Shellfish Immunology 139. https:/​/​doi.org/​10.1016/​j.fsi.2023.108879.
Google Scholar
Liu, S., E. Li, Y. Cai, S. Wang, Z. Ren, Q. Li, W. Guo, Y. Wu, and Y. Zhon. 2018. “Isolation, Identification and Pathogenicity Characterization of Vibrio Ponticus from the Golden Pompano Trachinotus Ovatus.” Aquaculture 496:285–90. https:/​/​doi.org/​10.1016/​j.aquaculture.2018.04.065.
Google Scholar
Lom, J., and I. Dyková. 1992. Protozoan Parasites of Fishes. Developments in Aquaculture and Fisheries Science 26. Amsterdam: Elsevier Science Publishers B.V.
Google Scholar
Moravec, F. 2023. Philometrid Nematodes Parasitic in Fishes. Academia.
Google Scholar
Muroga, K., G. Lio-po, C. Pitogo, and R. Imada. 1984. “Vibrio Sp. Isolated from Milkfish (Chanos Chanos) with Opaque Eyes.” Fish Pathology 19:81–87. https:/​/​doi.org/​10.3147/​jsfp.19.81.
Google Scholar
Nam, U.-H., H.-J. Seo, I. Hwang, and J.-H. Kim. 2020. “Neobenedenia Girellae Infection of Aquarium-Raised Snubnose Pompano (Trachinotus Blochii) in Korea.” Journal of Fish Pathology 33:15–21.
Google Scholar
Noga, E. J. 2010. Fish Disease. Diagnosis and Treatment. 2nd ed. Wiley-Blackwell. https:/​/​doi.org/​10.1002/​9781118786758.
Google Scholar
Pakingking, R., Jr., N. B. Bautista, D. Catedral, and E. G. de Jesus-Ayson. 2018. “Characterisation of Vibrio Isolates Recovered from the Eyes of Cage-Cultured Pompano (Trachinotus Blochii) Infested with Caligid Parasites (Lepeophtheirus Spinifer).” Bulletin of the European Association of Fish Pathologists 38:35–41. http:/​/​hdl.handle.net/​10862/​3252.
Google Scholar
Pakingking, R., Jr., K.-I. Mori, N. B. Bautista, E. G. de Jesus-Ayson, and O. Reyes. 2011. “Susceptibility of Hatchery-Reared Snubnose Pompano Trachinotus Blochii to Natural Betanodavirus Infection and Thein Imine Responses to the Inactivated Causative Virus.” Aquaculture 311:80–86. https:/​/​doi.org/​10.1016/​j.aquaculture.2010.11.035.
Google Scholar
Ransangan, J., M. Lai, and A. H. Al-Harbi. 2012. “Characterization and Experimental Infection of Vibrio Harveyi Isolated from Diseased Asian Seabass (Lates Calcarifer).” Malaysian Journal of Microbiology 8:104–15. https:/​/​doi.org/​10.21161/​mjm.03512.
Google Scholar
Řehulka, J., M. Marejková, and P. Petráš. 2020. “Staphylococcal Infections of Freshwater Fishes in Czech Republic.” Bulletin of the European Association of Fish Pathologists 40:189–98. https:/​/​eafp.org/​download/​2020-volume40/​issue_5/​40-5-189-rehulka.pdf.
Google Scholar
Řehulka, J., and O. Mráz. 1982. “Columnarosis in rainbow trout (Salmo gairdneri R.) in Czechoslovakia.” Acta Veterinaria Brno 51:125–37. https:/​/​doi.org/​10.2754/​avb198251010125.
Google Scholar
Scott, S. J., and T. K. Bollinger. 2014. “Flavobacterium Columnare: An Important Contributing Factor to Fish Die-Offs in Southern Lakes of Saskatchewan, Canada.” Journal of Veterinary Diagnostic Investigation 26:832–36. https:/​/​doi.org/​10.1177/​1040638714553591.
Google Scholar
Smith-Vaniz, W. F., B. B. Collette, and B. E. Luckhurst. 1999. “Fishes of Bermuda: History, Zoogeography, Annotated Checklist, and Identification Keys.” American Society of Ichthyologists and Herpetologists. Special Publication 4:424. https:/​/​pubs.usgs.gov/​publication/​70162457.
Google Scholar
Vu-Khac, H., V. Q. B. Duong, S. C. Chen, T. H. Pham, T. T. G. Nguyen, and T. T. H. Trinh. 2016. “Isolation and Genetic Characterization of Nocardia Seriolae from Snubnose Pompano Trachinotus Blochii in Vietnam.” Diseases of Aquatic Organisms 120:173–77. https:/​/​doi.org/​10.3354/​dao03023.
Google Scholar
Wright, A. D., and A. Colorni. 2002. “Taxonomic Re-Assignment of Cryptocaryon Irritans, a Marine Fish Parasite.” European Journal of Protistology 37:375–78. https:/​/​doi.org/​10.1078/​0932-4739-00858.
Google Scholar
Xie, Z. Y., C. Q. Hu, L. P. Zhang, C. Chen, C. H. Ren, and Q. Shen. 2007. “Identification and Pathogenicity of Vibrio Ponticus Affecting Cultured Japanese Sea Bass, Lateolabrax Japonicus (Cuvier in Cuvier and Valenciennes).” Letters in Applied Microbiology 45:62–67. https:/​/​doi.org/​10.1111/​j.1472-765X.2007.02141.x.
Google Scholar
Yambot, A. V., Y. L. Song, and H. H. Sung. 2003. “Characterization of Cryptocaryon Irritans, a Parasite Isolated from Marine Fishes in Taiwan.” Diseases of Aquatic Organisms 54:147–56. https:/​/​doi.org/​10.3354/​dao054147.
Google Scholar
Yu, Q., M. Liu, F. Li, Y. Wang, P. Li, et al. 2018. “Identification and Characterization of Marine Pathogenic Vibrios in Cultured Golden Pompano (Trachinotus Ovatus) in Guangxi, China.” Annals of Marine Science 2 (1): 016–019. https:/​/​doi.org/​10.17352/​ams.000010.
Google Scholar

Attachments

Powered by Scholastica, the modern academic journal management system